1
Plasmid 32297: pMS34
  • lacZ ORF with long 5'UTR

  • 3217

  • Escherichia coli

  • AAC73447.1 Gene ID: 945006

  • pMS26
    (Search Vector Database)

  • Bacterial Expression ; bacterial gene addition

  • 13150

  • USERBstBI fragment replaced with lacZ amplicon

  • rhaBp

  • USERBstBI

  • Yes

  • USERBstBI

  • Yes

  • GATCTAAACTATGACAATAAAG List of Sequencing Primers

  • na

  • Ampicillin

  • DH10B

  • 30

  • Following transformation and plating on rich Ampicillin (100 ug/ml) at 30C, restreak at 42C without drug on plates containing rhamnose and Xgal to obtain strains with insertion of mTn7(phi-lacZMS33) into attTn7

  • Low Copy

  • View sequences (2)
  • View map

  • Elisabeth Raleigh

  • UBMTA

Comments: 

Amplification and sequencing primers for verifying insertion into attTn7:

glmS-proximal (Tn7R side)
5’-AATCTGTAACGTTCCGGGTTC-3’ OR
5'-GATGCTGGTGGCGAAGCTGT-3'

pstS-proximal (Tn7L side)
5’-CATTAATAACGAAGAGATGAC-3’ OR
5'-GATGACGGTTTGTCACATGGA-3'

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32297" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with
32295: pMS26
32296: pMS33