1
Plasmid 32297: pMS34
  • lacZ ORF with long 5'UTR

  • 3217

  • Escherichia coli

  • AAC73447.1 Gene ID: 945006

  • pMS26
    (Search Vector Database)

  • Bacterial Expression ; bacterial gene addition

  • 13150

  • USERBstBI fragment replaced with lacZ amplicon

  • rhaBp

  • USERBstBI

  • Yes

  • USERBstBI

  • Yes

  • GATCTAAACTATGACAATAAAG List of Sequencing Primers

  • na

  • Ampicillin

  • DH10B

  • 30

  • Following transformation and plating on rich Ampicillin (100 ug/ml) at 30C, restreak at 42C without drug on plates containing rhamnose and Xgal to obtain strains with insertion of mTn7(phi-lacZMS33) into attTn7

  • Low Copy

  • View sequences (2)
  • View map

  • Elisabeth Raleigh

  • UBMTA

Comments: 

Amplification and sequencing primers for verifying insertion into attTn7:

glmS-proximal (Tn7R side)
5’-AATCTGTAACGTTCCGGGTTC-3’ OR
5'-GATGCTGGTGGCGAAGCTGT-3'

pstS-proximal (Tn7L side)
5’-CATTAATAACGAAGAGATGAC-3’ OR
5'-GATGACGGTTTGTCACATGGA-3'

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32297" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with
32295: pMS26
32296: pMS33