This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy in light of the new GDPR standards. When logging in or creating a new account, you will be asked to read and acknowledge these policy changes. Additionally, you can find our Transparency and Privacy Policy here.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #32297)


Item Catalog # Description Quantity Price (USD)
Plasmid 32297 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 13150
  • Modifications to backbone
    USERBstBI fragment replaced with lacZ amplicon
  • Vector type
    Bacterial Expression ; bacterial gene addition

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Following transformation and plating on rich Ampicillin (100 ug/ml) at 30C, restreak at 42C without drug on plates containing rhamnose and Xgal to obtain strains with insertion of mTn7(phi-lacZMS33) into attTn7
  • Copy number
    Low Copy


  • Gene/Insert name
    lacZ ORF with long 5'UTR
  • Species
    Escherichia coli
  • Insert Size (bp)
  • GenBank ID
    AAC73447.1 Gene ID: 945006
  • Promoter rhaBp

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site USERBstBI (destroyed during cloning)
  • 3′ cloning site USERBstBI (destroyed during cloning)
  • 5′ sequencing primer GATCTAAACTATGACAATAAAG
  • 3′ sequencing primer na
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Amplification and sequencing primers for verifying insertion into attTn7:

glmS-proximal (Tn7R side)

pstS-proximal (Tn7L side)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMS34 was a gift from Elisabeth Raleigh (Addgene plasmid # 32297)
  • For your References section:

    A versatile element for gene addition in bacterial chromosomes. Sibley MH, Raleigh EA. Nucleic Acids Res. 2012 Feb;40(3):e19. doi: 10.1093/nar/gkr1085. Epub 2011 Nov 28. 10.1093/nar/gkr1085 PubMed 22123741