Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-GFP
(Plasmid #32395)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32395 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSub201
  • Backbone size w/o insert (bp) 8310
  • Vector type
    Mammalian Expression, AAV ; Adeno-Associated Virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Users must confirm the absence of deletions (recombinations) in this vector by diagnostic digests. (1) A SmaI digest should produce the following pattern of bands: 3654 bp, 1716 bp and 1500 bp. (2) An AhdI digest should produce the following pattern of bands: 3183 bp, 2582 bp and 1127 bp. Please consult the associated publication listed below for an example gel image.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Multiple (see map) (not destroyed)
  • 3′ cloning site Multiple (see map) (not destroyed)
  • 5′ sequencing primer GGCCCTTTTGCTAATCATGTTCATACCTCTTATCT
  • 3′ sequencing primer GGCCAGGGCATTAGCCACACCAG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please see Notes from Addgene link above for Addgene's diagnostic digests of this plasmid with AhdI and SmaI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-GFP was a gift from John T Gray (Addgene plasmid # 32395 ; http://n2t.net/addgene:32395 ; RRID:Addgene_32395)
  • For your References section:

    Design and Construction of Functional AAV Vectors. Gray JT, Zolotukhin S. Methods Mol Biol. 2011;807:25-46. 10.1007/978-1-61779-370-7_2 PubMed 22034025