Addgene - pCMV-HA (New MCS) Plasmid Data

Plasmid 32530: pCMV-HA (New MCS)

Gene/insert name:
None
Vector backbone:
pCMV-HA
(Search Vector Database)
Backbone manufacturer:
Clontech
Vector type:
Mammalian Expression
Backbone size (bp):
3800
Modifications to Backbone:
Multiple cloning site (MCS) was changed from SfiI, EcoRI, SalI, BglII, XhoI, KpnI and NotI to match the MCS of the pCAGIG vector (Addgene plasmid #11159) EcoRI, XhoI, EcoRV and NotI. This changes the frame for fusion to the HA tag. Top oligo: 5'- AGGAATTCCTCGAGGATATCGC -3' and Bottom oligo 5'- GGCCGCGATATCCTCGAGGAATTCCTCCA -3' were annealed and ligated into SfiI/NotI cut pCMV-HA. The SfiI site was destroyed in the process.
Fusion protein or tag:
HA
Terminal:
N terminal on backbone
Bacterial resistance(s)
Ampicillin
Growth strain(s)
DH5alpha
Growth temperature (℃):
37
High or low copy:
High Copy
Sequence: View sequences (2)
Principal Investigator:
Christopher A Walsh
Terms and Licenses:
MTA

Comments:

Multiple cloning site (MCS) was changed from SfiI, EcoRI, SalI, BglII, XhoI, KpnI and NotI to match the MCS of the pCAGIG vector (Addgene plasmid #11159) EcoRI, XhoI, EcoRV and NotI. This changes the frame for fusion to the HA tag.

Top oligo: 5'- AGGAATTCCTCGAGGATATCGC -3' and Bottom oligo 5'- GGCCGCGATATCCTCGAGGAATTCCTCCA -3' were annealed and ligated into SfiI/NotI cut pCMV-HA. The SfiI site was destroyed in the process.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32530" in your Materials and Methods section.