1
Plasmid 32571: pTYF-3.6TPH-GAL4p65
  • Gal4p65

  • 1062

  • M. musculus (mouse), S. cerevisiae (budding yeast)

  • pTYF
    (Search Vector Database)

  • Lentiviral

  • 7469

  • 3.6TPH

  • SpeI

  • No

  • NotI

  • No

  • atgaagctactgtcttctatcgaac List of Sequencing Primers

  • Amp (50 ug/mL)

  • DH5alpha

  • 30

  • High Copy

  • View sequences (2)
  • View map

  • Sergey Kasparov

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Targeting central serotonergic neurons with lentiviral vectors based on a transcriptional amplification strategy. Benzekhroufa et al (Gene Ther. 2009 May;16(5):681-8. Epub 2009 Feb 12. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32571" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with
32569: pTYF-G4BS-2TPH-EGFP-IRES-GAL4p65