1
Plasmid 32572: pXcX-G4BS-3.6TPH-EGFP
  • EGFP

  • 798

  • jellyfish

  • pXcX
    (Search Vector Database)

  • Mammalian Expression, Adenoviral

  • 7076

  • 3.6TPH

  • SpeI

  • No

  • NotI

  • No

  • atggtgagcaagggcgaggagctg List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 30

  • Low Copy

  • View sequences (2)
  • View map

  • Sergey Kasparov

  • MTA

Comments: 

Please note that Addgene's quality control sequence shows A inserted relative to the author's sequence. There is no evidence that this insertion affects the function of the plasmid.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Adenoviral vectors for highly selective gene expression in central serotonergic neurons reveal quantal characteristics of serotonin release in the rat brain. Benzekhroufa et al (BMC Biotechnol. 2009 Mar 19;9:23. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32572" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with