Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pENTR-R4r-HCN1miR-EGFP-R3r
(Plasmid #32586)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32586 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDONR221 P4r-P3r
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Gateway cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Intronic HCN1miRNA and EGFP

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The HCN1miR was cloned into pSM155-GFP provided by Guangwei Du, University of Texas Health Science Center, Houston. A cassette containing the intronic miRNA upstream of EGFP was then amplified with PCR primers containing att sites and recombined to generate the entry vector.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HCN1miRNA TAAAGACGACAGTAGGTATCAG

Du, G., Yonekubo, J., Zeng, Y., Osisami, M., and Frohman, M. A. (2006). Design of expression vectors for RNA interference based on miRNAs and RNA splicing. FEBS J. 273, 5421–5427.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR-R4r-HCN1miR-EGFP-R3r was a gift from Matthew Nolan (Addgene plasmid # 32586 ; http://n2t.net/addgene:32586 ; RRID:Addgene_32586)
  • For your References section:

    A Molecular Toolbox for Rapid Generation of Viral Vectors to Up- or Down-Regulate Neuronal Gene Expression in vivo. White MD, Milne RV, Nolan MF. Front Mol Neurosci. 2011;4:8. Epub 2011 Jul 4. 10.3389/fnmol.2011.00008 PubMed 21772812