This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #32588)


Item Catalog # Description Quantity Price (USD)
Plasmid 32588 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pDONR221 P3-P2
  • Backbone manufacturer
  • Vector type
    Gateway cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Intronic Luciferase miRNA and EGFP

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pSM155-Luc-GFP was provided by Guangwei Du, University of Texas Health Science Center, Houston. A cassette containing the intronic Luciferase miRNA upstream of EGFP was then amplified with PCR primers containing att sites and recombined to generate the entry vector.
  • Terms and Licenses

Depositor Comments

LucmiRNA atttgtattcagcccatatcgg

Du, G., Yonekubo, J., Zeng, Y., Osisami, M., and Frohman, M. A. (2006). Design of expression vectors for RNA interference based on miRNAs and RNA splicing. FEBS J. 273, 5421–5427.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR-L3-LucmiR-EGFP-L2 was a gift from Matthew Nolan (Addgene plasmid # 32588)
  • For your References section:

    A Molecular Toolbox for Rapid Generation of Viral Vectors to Up- or Down-Regulate Neuronal Gene Expression in vivo. White MD, Milne RV, Nolan MF. Front Mol Neurosci. 2011;4:8. Epub 2011 Jul 4. 10.3389/fnmol.2011.00008 PubMed 21772812