pCAG:H2B-EGFP
(Plasmid #32599)

• Depositing Labs: Anna-Katerina Hadjantonakis, Virginia Papaioannou
• Publication: Hadjantonakis et al BMC Biotechnol. 2004 Dec 24;4:33.

Backbone

• Vector backbone: pCAGGS
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: H2B-EGFP
• GenBank ID: X00088 X57127
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: IMR 872 AAGTTCATCTGCACCACCG
• 3′ sequencing primer: IMR 873 TGCTCAGGTAGTGGTTGTCG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The coding sequence for the human histone H2B gene
(X57127) was amplified from genomic DNA by PCR
using Pfx Polymerase (Invitrogen). The resulting product
was cloned into pCR4 TOPO (Invitrogen) to generate
pH2B. The H2B fragment was then cloned into plasmids
pEGFP-N1, pDsRed2-N1 pDsRedExpress-N1 (BD Biosciences, Inc) in order to generate plasmids pH2B-EGFP,
pH2B-DsRed2 and pH2B-DsRedExpress (oligonucleotide
sequences are available upon request). The resulting
fusions were then re-amplified by PCR and cloned into
the XhoI site of pCAGGS [19] to generate pCX-H2B-EGFP,
pCX-H2B-DsRed2 and pCX-H2B-DsRedExpress.