Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pTGMP-p16/p19.478
(Plasmid #32717)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32717 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCV-IRES-GFP
  • Backbone size w/o insert (bp) 7538
  • Modifications to backbone
    SIN LTR TRE-GFP-mir30 cassette
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10/P3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    p16/p19
  • gRNA/shRNA sequence
    ctcgagaaggtatattgctgttgacagtgagcgcccgctgggtgctctttgtgtttagtgaagccacagatgtaaacacaaagagcacccagcggatgcctactgcctcggaattc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer EGFP-C
  • 3′ sequencing primer MSCV-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTGMP-p16/p19.478 was a gift from Scott Lowe (Addgene plasmid # 32717 ; http://n2t.net/addgene:32717 ; RRID:Addgene_32717)
  • For your References section:

    A rapid and scalable system for studying gene function in mice using conditional RNA interference. Premsrirut PK, Dow LE, Kim SY, Camiolo M, Malone CD, Miething C, Scuoppo C, Zuber J, Dickins RA, Kogan SC, Shroyer KR, Sordella R, Hannon GJ, Lowe SW. Cell. 2011 Apr 1;145(1):145-58. 10.1016/j.cell.2011.03.012 PubMed 21458673