1
Plasmid 32720: pCol-TGM-luc.1309
  • luciferase

  • ctcgagaaggtatattgctgttgacagtgagcgcccgcctgaagtctctgattaatagt gaagccacagatgtattaatcagagacttcaggcggttgcctactgcctcggaattc

  • pBS31'-RBGpA
    (Search Vector Database)

  • Jaensich laboratory

  • Mouse Targeting, RNAi

  • 6120

  • GFP-miR30 cassette addition Xho mutation

  • TRE

  • Tre

  • XhoI

  • No

  • EcoRI

  • No

  • EGFP-C List of Sequencing Primers

  • Bglob-intron-R

  • Ampicillin

  • Top10/P3

  • 37

  • Unknown

  • View sequences (2)
  • Scott Lowe

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A rapid and scalable system for studying gene function in mice using conditional RNA interference. Premsrirut et al (Cell. 2011 Apr 1;145(1):145-58. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32720" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only