-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerBD Clontech
- Backbone size w/o insert (bp) 4749
-
Modifications to backboneC1 vector frame shifted by cutting with BglII, blunting, and religating.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTalin-1 Head aa 1-433
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1299
-
GenBank IDX56123 CAA39588.1
-
Entrez GeneTln1 (a.k.a. Tln)
-
Tag
/ Fusion Protein
- Enhanced GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Sal1 (not destroyed)
- 5′ sequencing primer EGFP_C_prime CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEGFP-talin1 head was cloned by excising the talin1 head cDNA (encoding aa 1–433) by EcoRI/SalI digestion from the pJ6 R vector (a gift from R. Hynes, Massachusetts Institute of Technology, Cambridge, MA)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the most appropriate reference sequence for the Talin1 insert in this plasmid is GenBank accession number CAA39588.1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-talin1 head was a gift from Anna Huttenlocher (Addgene plasmid # 32856 ; http://n2t.net/addgene:32856 ; RRID:Addgene_32856) -
For your References section:
Talin1 regulates TCR-mediated LFA-1 function. Simonson WT, Franco SJ, Huttenlocher A. J Immunol. 2006 Dec 1;177(11):7707-14. PubMed 17114441