Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pLG-Nde-Acc
(Plasmid #33150)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 33150 Plasmid sent as bacteria in agar stab 1 $65 Add to Cart
Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    TG1
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RP51A-synthetic minimal intron
  • Species
    S. cerevisiae (budding yeast)
  • Mutation
    AccI site in intron was cut/filled/ligated to change GTCGAC to GTCGCGAC, and NdeI site after intron was cut/filled and a BamHI linker was inserted to obtain the appropriate reading frame changing CATATG to CATACGGGATCC
  • Entrez Gene
    RPS17A (a.k.a. YML024W, RP51A, RPL51A)
  • Tag / Fusion Protein
    • LacZ (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer none
  • 3′ sequencing primer LacZ-R
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLG-Nde-Acc was a gift from Michael Rosbash (Addgene plasmid # 33150)
  • For your References section:

    Some cis- and trans-acting mutants for splicing target pre-mRNA to the cytoplasm. Legrain P, Rosbash M. Cell. 1989 May 19;57(4):573-83. 10.1016/0092-8674(89)90127-X PubMed 2655924