Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAC-Luc
(Plasmid #33154)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 33154 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAc5.1/V5-His B
  • Backbone manufacturer
    Invitrogen
  • Backbone size (bp) 5400
  • Modifications to backbone
    A PCR product containing the Firefly Luciferase gene and an artificial poly-linker sequence was ligated into pAC5.1/V5-His B between the 5' KpnI and 3' XhoI sites. Primers: Forward: GGATCGGGGTACCTATGGAAGACGCCAAAAACATAAAG Reverse: CACTAGACTCGAGCGTTACAATTTGGACTTTCCGCC Because of the stop codon, V5 and His Tags are not expressed. Restriction sites 3' of Luciferase are Xho1-XbaI-ApaI-BtgI-SacII-V5-MluI-AgeI-6xHIS-PmeI-DraI-StuI-SacI.
  • Vector type
    Insect Expression, Luciferase
  • Promoter Actin 5C
  • Selectable markers
    Hygromycin, Blasticidin
  • Tag / Fusion Protein
    • Luciferase (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC-Luc was a gift from Michael Rosbash (Addgene plasmid # 33154 ; http://n2t.net/addgene:33154 ; RRID:Addgene_33154)
  • For your References section:

    Clockwork Orange is a transcriptional repressor and a new Drosophila circadian pacemaker component. Kadener S, Stoleru D, McDonald M, Nawathean P, Rosbash M. Genes Dev. 2007 Jul 1;21(13):1675-86. Epub 2007 Jun 19. 10.1101/gad.1552607 PubMed 17578907