1
Plasmid 33154: pAC-Luc
  • None

  • pAc5.1/V5-His B
    (Search Vector Database)

  • Invitrogen

  • Insect Expression, Retroviral, Luciferase

  • 5400

  • A PCR product containing the Firefly Luciferase gene and an artificial poly-linker sequence was ligated into pAC5.1/V5-His B between the 5' KpnI and 3' XhoI sites. Primers: Forward: GGATCGGGGTACCTATGGAAGACGCCAAAAACATAAAG Reverse: CACTAGACTCGAGCGTTACAATTTGGACTTTCCGCC Because of the stop codon, V5 and His Tags are not expressed. Restriction sites 3' of Luciferase are Xho1-XbaI-ApaI-BtgI-SacII-V5-MluI-AgeI-6xHIS-PmeI-DraI-StuI-SacI.

  • Actin 5C

  • Luciferase

  • N terminal on backbone

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • Hygromycin, Blasticidin

  • View sequences (1)
  • Michael Rosbash

  • MTA
    Luciferase Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Clockwork Orange is a transcriptional repressor and a new Drosophila circadian pacemaker component. Kadener et al (Genes Dev. 2007 Jul 1;21(13):1675-86. Epub 2007 Jun 19. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 33154" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only