-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepeGFP(N1)
-
Backbone manufacturerclontech
- Backbone size w/o insert (bp) 4733
-
Modifications to backboneCMV promoter is partially deleted.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerat Syntaxin1a
-
Alt namerSYX1a
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)863
-
GenBank IDNM_053788
-
Entrez GeneStx1a
- Promoter cmv
-
Tag
/ Fusion Protein
- meGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site AgeI (unknown if destroyed)
- 5′ sequencing primer tgggaggtctatataagcag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDelta CMV promoter was cut out from Delta CMV-GFP-Vinculin (waterman lab) with Ase1 and Nhe1to replace CMV promoter in syntaxin 1a GFP in same sites
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
peGFP(N1)-deltaCMV-rSyntaxin1a-meGFP was a gift from Wolfhard Almers (Addgene plasmid # 34631 ; http://n2t.net/addgene:34631 ; RRID:Addgene_34631) -
For your References section:
Single secretory granules of live cells recruit syntaxin-1 and synaptosomal associated protein 25 (SNAP-25) in large copy numbers. Barg S, Knowles MK, Chen X, Midorikawa M, Almers W. Proc Natl Acad Sci U S A. 2010 Nov 30;107(48):20804-9. Epub 2010 Nov 12. 10.1073/pnas.1014840107 PubMed 21076040