pQTEV-SESN2
(Plasmid
#34820)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34820 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQTEV
- Backbone size w/o insert (bp) 4700
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Rosetta
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesestrin 2
-
Alt namePSFEp250F043
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1515
-
GenBank IDCAB66486 DQ000576
-
Entrez GeneSESN2 (a.k.a. HI95, SES2, SEST2)
-
Tags
/ Fusion Proteins
- His (N terminal on backbone)
- TEV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (destroyed during cloning)
- 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
- 3′ sequencing primer GGCAACCGAGCGTTCTGAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQTEV-SESN2 was a gift from Konrad Buessow (Addgene plasmid # 34820 ; http://n2t.net/addgene:34820 ; RRID:Addgene_34820) -
For your References section:
Structural genomics of human proteins--target selection and generation of a public catalogue of expression clones. Bussow K, Scheich C, Sievert V, Harttig U, Schultz J, Simon B, Bork P, Lehrach H, Heinemann U. Microb Cell Fact. 2005 Jul 5. 4():21. 10.1186/1475-2859-4-21 PubMed 15998469