-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34886 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV-VSV-G
- Backbone size w/o insert (bp) 5000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSindbis virus envelope protein
-
SpeciesSindbus Virus
-
Insert Size (bp)3400
-
GenBank IDAAA96976.1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstEII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer pCMV-VSV-G-Fwd: AACCGGGCCCCTCTGCTAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
m168 is a mutated version of the Sinbis virus envelope protein, which includes the following mutations:
E3 domain--delta 61-64
E2 domain-- SLKQ68-71AAAA and KE159-160AA
ZZ domain of protein A inserted into E2 domain
This plasmid was created using Addgene Plasmid pCMV-VSV-G (#8454), where the VSV-G was removed and replaced with the Sindbis virus envelope protein (above).
See attached map for details on construction and recommended restriction digest analysis.
Please note that the Addgene sequencing results also found an R172G point mutation in the E2 domain--this is not expected to alter the function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
m168 was a gift from Irvin Chen (Addgene plasmid # 34886 ; http://n2t.net/addgene:34886 ; RRID:Addgene_34886) -
For your References section:
Lentiviral vector retargeting to P-glycoprotein on metastatic melanoma through intravenous injection. Morizono K, Xie Y, Ringpis GE, Johnson M, Nassanian H, Lee B, Wu L, Chen IS. Nat Med. 2005 Mar;11(3):346-52. Epub 2005 Feb 13. 10.1038/nm1192 PubMed 15711560