p6590 MSCV-IP N-HAonly TCTE1
(Plasmid
#34904)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34904 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV-IP N-HAonly
-
Backbone manufacturerGateway
- Backbone size w/o insert (bp) 8100
-
Modifications to backbone(NTap mod. by E.White to remove Flag)
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTCTE1
-
SpeciesH. sapiens (human)
-
Entrez GeneTCTE1 (a.k.a. RP11-444E17.2, D6S46)
- Promoter MSCV LTR
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer 5' CTACATCGTGACCTGGGAAGC 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p6590 MSCV-IP N-HAonly TCTE1 was a gift from Peter Howley (Addgene plasmid # 34904 ; http://n2t.net/addgene:34904 ; RRID:Addgene_34904) -
For your References section:
Systematic identification of interactions between host cell proteins and E7 oncoproteins from diverse human papillomaviruses. White EA, Sowa ME, Tan MJ, Jeudy S, Hayes SD, Santha S, Munger K, Harper JW, Howley PM. Proc Natl Acad Sci U S A. 2012 Jan 9. 10.1073/pnas.1116776109 PubMed 22232672