Plasmid 35001: Otx2
  • Homeobox protein OTX2

  • Otx2

  • 870

  • M. musculus (mouse)

  • NT_039606.7

  • Otx2 (E130306E05Rik)

  • pCCL-cppt-PGK-WPRE
    (Search Vector Database)

  • Malin Parmar

  • Mammalian Expression, Lentiviral

  • 7041

  • BamHI

  • No

  • SalI

  • No

  • GCAGAGGTCCTATCCCATGA List of Sequencing Primers


  • Ampicillin

  • Stbl3

  • 37

  • Unknown

  • View sequences (2)
  • Malin Parmar


Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Direct conversion of human fibroblasts to dopaminergic neurons. Pfisterer et al (Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Epub 2011 Jun 6. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35001" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only