Otx2
(Plasmid #35001)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pCCL-cppt-PGK-WPRE
  • Backbone manufacturer
    Malin Parmar
  • Backbone size w/o insert (bp) 7041
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Sequence Information

Gene/Insert

  • Gene/Insert name
    Homeobox protein OTX2
  • Alt name
    Otx2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    870
  • GenBank ID
    NT_039606.7
  • Entrez Gene
    Otx2 (a.k.a. E130306E05Rik)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GCAGAGGTCCTATCCCATGA
  • 3′ sequencing primer GGAAGTTGAGCCAGCATAGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Otx2 was a gift from Malin Parmar (Addgene plasmid # 35001)
  • For your References section:

    Direct conversion of human fibroblasts to dopaminergic neurons. Pfisterer U, Kirkeby A, Torper O, Wood J, Nelander J, Dufour A, Bjorklund A, Lindvall O, Jakobsson J, Parmar M. Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Epub 2011 Jun 6. 10.1073/pnas.1105135108 PubMed 21646515