1
Plasmid 35017: p6621 MSCV-IP N-HAonly SRC
  • SRC

  • H. sapiens (human)

  • SRC (RP5-823N20.1, ASV, SRC1, c-SRC, p60-Src)

  • HA

  • N terminal on backbone

  • MSCV-IP N-HAonly
    (Search Vector Database)

  • Mammalian Expression

  • 8100

  • NTap mod. by E.White to remove Flag

  • MSCV LTR

  • Gateway Cloning

  • 5' CTACATCGTGACCTGGGAAGC 3' List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • Puromycin

  • View sequences (1)
  • Peter Howley

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Systematic identification of interactions between host cell proteins and E7 oncoproteins from diverse human papillomaviruses. White et al (Proc Natl Acad Sci U S A. 2012 Jan 9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35017" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only