Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pmCherry-C1-FAK-HA
(Plasmid #35039)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35039 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmCherry-c1
  • Backbone manufacturer
    BD Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    focal adhesion kinase
  • Alt name
    FAK
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3150
  • Mutation
    Y42H; deletion of amino acids 1051 & 1052
  • Entrez Gene
    Ptk2 (a.k.a. FA, FADK 1, FAK, FR, FRNK, Fad, Fadk, p125FAK)
  • Tags / Fusion Proteins
    • mCherry (N terminal on insert)
    • 2x HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl 2 (not destroyed)
  • 3′ cloning site Kpn 1 (not destroyed)
  • 5′ sequencing primer GACAGATCTATGGCAGCTGCTTATCTTGACCCAAAC
  • 3′ sequencing primer 5' GTAGGTACCTTATCTAGATCCGGTGGATC 3'
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that Addgene's sequencing result identified a Y42H mutation when compared to the full plasmid sequence provided by the depositing laboratory and to GenBank entry NP_032008.2.

The final two FAK amino acids are missing in this construct, as the original source for the FAK construct used in this plasmid was originally missing these same amino acids. The depositing laboratory states that the deletion should not affect any FAK function since it is outside of the FAK primary sequence.

Addgene's sequencing results also identified a deletion region from bp#4553-4588 when compared to the full plasmid sequence provided by the depositing laboratory. This indicates that the restriction sites KpnI (4561), SacII (4564) and ApaI (4569) are not present in the vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-C1-FAK-HA was a gift from Anna Huttenlocher (Addgene plasmid # 35039 ; http://n2t.net/addgene:35039 ; RRID:Addgene_35039)
  • For your References section:

    Regulation of adhesion dynamics by calpain-mediated proteolysis of focal adhesion kinase (FAK). Chan KT, Bennin DA, Huttenlocher A. J Biol Chem. 2010 Apr 9;285(15):11418-26. Epub 2010 Feb 11. 10.1074/jbc.M109.090746 PubMed 20150423