Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSSA-1-3
(Plasmid #35091)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35091 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3-control
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5256
  • Modifications to backbone
    Luciferase gene is split into two inactive fragments containing overlapping homologies with a ZFN site between them. In cells, cleavage at the ZFN site will initiate single strand annealing and generate an active luciferase gene.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Split luciferase for GZF1/3 SSA assay
  • Alt name
    Firefly luciferase
  • Insert Size (bp)
    906
  • Mutation
    Single strand annealing (SSA) recombinaion reporter assay containing target site for GZF1/3 zinc finger nuclease
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer LucRep-f: CGAAGGTTGTGGATCTGGATACC
  • 3′ sequencing primer LucRep-r: TAGCTGATGTAGTCTCAGTGAGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Originally described in Szczepek, M., Brondani, V., Büchel, J., Serrano, L., Segal, D.J. and Cathomen, T. (2007) Structure-based redesign of the dimerization interface reduces the toxicity of zinc finger nucleases. Nat. Biotechnol., 25:786-793.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSSA-1-3 was a gift from David Segal (Addgene plasmid # 35091 ; http://n2t.net/addgene:35091 ; RRID:Addgene_35091)
  • For your References section:

    The generation of zinc finger proteins by modular assembly. Bhakta MS, Segal DJ. Methods Mol Biol. 2010;649:3-30. 10.1007/978-1-60761-753-2_1 PubMed 20680825