1
Plasmid 35092: pPGK-GZF1-RR
  • ZFN GZF1-Fok(RR)

  • 1000

  • synthetic

  • HA

  • N terminal on insert

  • SV40 NLS

  • N terminal on insert

  • contains the "RR" obligate heterodimer variant

  • pPGK
    (Search Vector Database)

  • Mammalian Expression

  • 4500

  • PGK

  • XhoI

  • No

  • AgeI

  • No

  • HAtag-f: ATGTACCCATACGATGTCCCAGACTACG List of Sequencing Primers

  • FokLinkSeq-r: TCTATCCTGAGTGGAATTTCTGGC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • View map

  • View map

  • David Segal

  • MTA

Comments: 

Originally described in Szczepek, M., Brondani, V., Büchel, J., Serrano, L., Segal, D.J. and Cathomen, T. (2007) Structure-based redesign of the dimerization interface reduces the toxicity of zinc finger nucleases. Nat. Biotechnol., 25:786-793.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: The generation of zinc finger proteins by modular assembly. Bhakta et al (Methods Mol Biol. 2010;649:3-30. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35092" in your Materials and Methods section.