1
Plasmid 35144: p6651 MSCV-P C-Flag HA 76E7-Kozak
  • HPV76 E7

  • Human papillomavirus type 76

  • FLAG

  • C terminal on backbone

  • HA

  • C terminal on backbone

  • MSCV-P C-Flag-HA
    (Search Vector Database)

  • Mammalian Expression

  • 300

  • Gateway Cloning

  • 5' CTACATCGTGACCTGGGAAGC 3' List of Sequencing Primers

  • MSCV-rev

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • Puromycin

  • View sequences (1)
  • Peter Howley

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Systematic identification of interactions between host cell proteins and E7 oncoproteins from diverse human papillomaviruses. White et al (Proc Natl Acad Sci U S A. 2012 Jan 9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35144" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with