Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

p6651 MSCV-P C-Flag HA 76E7-Kozak
(Plasmid #35144)

Loading...
Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    MSCV-P C-Flag-HA
  • Backbone size w/o insert (bp) 300
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    HPV76 E7
  • Species
    Human papillomavirus type 76
  • Tags / Fusion Proteins
    • FLAG (C terminal on backbone)
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer 5' CTACATCGTGACCTGGGAAGC 3'
  • 3′ sequencing primer MSCV-rev
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p6651 MSCV-P C-Flag HA 76E7-Kozak was a gift from Peter Howley (Addgene plasmid # 35144)
  • For your References section:

    Systematic identification of interactions between host cell proteins and E7 oncoproteins from diverse human papillomaviruses. White EA, Sowa ME, Tan MJ, Jeudy S, Hayes SD, Santha S, Munger K, Harper JW, Howley PM. Proc Natl Acad Sci U S A. 2012 Jan 9. 10.1073/pnas.1116776109 PubMed 22232672