Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p6656 MSCV-P C-Flag HA 25E7-Kozak
(Plasmid #35149)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35149 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCV-P C-Flag-HA
  • Backbone size w/o insert (bp) 8700
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HPV25 E7
  • Species
    Human papillomavirus type 25
  • Insert Size (bp)
    300
  • Tags / Fusion Proteins
    • FLAG (C terminal on backbone)
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer 5' CTACATCGTGACCTGGGAAGC 3'
  • 3′ sequencing primer MSCV-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p6656 MSCV-P C-Flag HA 25E7-Kozak was a gift from Peter Howley (Addgene plasmid # 35149 ; http://n2t.net/addgene:35149 ; RRID:Addgene_35149)
  • For your References section:

    Systematic identification of interactions between host cell proteins and E7 oncoproteins from diverse human papillomaviruses. White EA, Sowa ME, Tan MJ, Jeudy S, Hayes SD, Santha S, Munger K, Harper JW, Howley PM. Proc Natl Acad Sci U S A. 2012 Jan 9. 10.1073/pnas.1116776109 PubMed 22232672