Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pLKO-tet-puro-sh-control
(Plasmid #35163)

Loading...
Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pLKO-tet-puro
  • Backbone size w/o insert (bp) 10000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    shRNAi against GFP#1
  • gRNA/shRNA sequence
    GCAAGCTGACCCTGAAGTTCAT
  • Insert Size (bp)
    55
  • Promoter hPGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer H1
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-tet-puro-sh-control was a gift from Benjamin Blencowe (Addgene plasmid # 35163)
  • For your References section:

    An alternative splicing switch regulates embryonic stem cell pluripotency and reprogramming. Gabut M, Samavarchi-Tehrani P, Wang X, Slobodeniuc V, O'Hanlon D, Sung HK, Alvarez M, Talukder S, Pan Q, Mazzoni EO, Nedelec S, Wichterle H, Woltjen K, Hughes TR, Zandstra PW, Nagy A, Wrana JL, Blencowe BJ. Cell. 2011 Sep 30;147(1):132-46. Epub 2011 Sep 15. 10.1016/j.cell.2011.08.023 PubMed 21924763