1
Plasmid 35163: pLKO-tet-puro-sh-control
  • shRNAi against GFP#1

  • 55

  • GCAAGCTGACCCTGAAGTTCAT

  • pLKO-tet-puro
    (Search Vector Database)

  • Mammalian Expression, Lentiviral, RNAi

  • 10000

  • hPGK

  • AgeI

  • Unknown

  • EcoRI

  • Unknown

  • H1 List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • View sequences (2)
  • Benjamin Blencowe

  • MTA
    Tet Systems Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: An alternative splicing switch regulates embryonic stem cell pluripotency and reprogramming. Gabut et al (Cell. 2011 Sep 30;147(1):132-46. Epub 2011 Sep 15. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35163" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only