1
Plasmid 35168: pLKO-tet-puro-sh-ex16b
  • Foxp1

  • GACGAGCTTGGCGCACATAAC

  • M. musculus (mouse)

  • Foxp1 (3110052D19Rik, 4932443N09Rik, AI461938, AW494214)

  • pLKO.1
    (Search Vector Database)

  • Mammalian Expression, Lentiviral, RNAi

  • 7000

  • AgeI

  • Unknown

  • EcoRI

  • Unknown

  • H1 List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • Puromycin

  • View sequences (1)
  • Benjamin Blencowe

  • MTA
    Tet Systems Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: An alternative splicing switch regulates embryonic stem cell pluripotency and reprogramming. Gabut et al (Cell. 2011 Sep 30;147(1):132-46. Epub 2011 Sep 15. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35168" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only