Plasmid 35230: yap1_R (OZ590)

• Gene/insert name: Zinc finger array targeting yap1
• Alt name: yap1
• Insert size: 270
• Species: D. rerio (zebrafish)
• Entrez Gene: yap1 (CH211-181P1.5, YAP65, cb194, sb:cb194, si:ch211-181p1.5, si:dkey-3b8.3, wu:fc18c04, zgc:158380)
  
• Vector backbone: MG414
  (Search Vector Database)
• Vector type: Zebrafish Targeting
• Backbone size w/o insert (bp): 5493
• Cloning site 5': XbaI
• Site destroyed during cloning: No
• Cloning site 3': BamHI
• Site destroyed during cloning: No
• 5' sequencing primer: OK.61 GGGTAGTACGATGACGGAACCTGTC
• Bacterial resistance(s) Kanamycin
• Growth strain(s) XL1 Blue
• Growth temperature (℃): 37
• Growth instructions: Requires a bacterial strain such as XL1 Blue, that expresses the lacIq allele of lac repressor
• High or low copy: Low Copy
• Sequence: View sequences (2)
• Principal Investigator: Keith Joung
• Terms and Licenses: MTA

Comments: 

This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene yap1. Please note that this plasmid does NOT contain the yap1 sequence.

Users must order the complementary plasmid yap1_L (OZ589) [Addgene plasmid 35229] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.

Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290/292 (Addgene plasmids 21872 & 21873), pMLM800/802 (Addgene plasmids 27202 & 27203).

The difference between pMLM800/802 and pMLM290/292 is the length of the “spacer” sequence in the full ZFN target site. If the spacer is 7 bp, scientists should use pMLM800/802. If the spacer is 5 or 6 bps, scientists should use pMLM290/292.

pMLM290/292 is identical to pST1374 except that it harbors two mutations in the FokI nuclease domain (Q486E, I499L; aka the “-“ mutation see Miller et al., Nat. Biotech 2007, PMID 17603475) which confers heterodimeric behavior on these domains

This zinc finger array was tested for binding activity to the sequence 5'-GCAGGTGAG-3' in a bacterial two hybrid assay, and resulted in 7.1 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).

Scientists using this zinc finger array in a publication should notify zebrafishzfs@zincfingers.org and acknowledge NIH grant number R01 GM088040 in the publication.

Other Articles: "Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082)

"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934)

Article: Rapid "open-source" engineering of customized zinc-finger nucleases for highly efficient gene modification. Maeder et al (Mol Cell. 2008 Jul 25. 31(2):294-301. PubMed)