1
Plasmid 35238: zgc:111821_R (OZ598)
  • Zinc finger array targeting zgc:111821

  • zgc:111821

  • 270

  • D. rerio (zebrafish)

  • zgc:111821 (spp1)

  • MG414
    (Search Vector Database)

  • Zebrafish Targeting

  • 5493

  • XbaI

  • No

  • BamHI

  • No

  • OK.61 GGGTAGTACGATGACGGAACCTGTC List of Sequencing Primers

  • Kanamycin

  • XL1 Blue

  • 37

  • Requires a bacterial strain such as XL1 Blue, that expresses the lacIq allele of lac repressor

  • Low Copy

  • View sequences (2)
  • Keith Joung

  • MTA

Comments: 

This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene zgc:111821. Please note that this plasmid does NOT contain the zgc:111821 sequence.

Users must order the complementary plasmid zgc:111821_L (OZ597) [Addgene plasmid 35237] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.

Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290/292 (Addgene plasmids 21872 & 21873), pMLM800/802 (Addgene plasmids 27202 & 27203).

The difference between pMLM800/802 and pMLM290/292 is the length of the “spacer” sequence in the full ZFN target site. If the spacer is 7 bp, scientists should use pMLM800/802. If the spacer is 5 or 6 bps, scientists should use pMLM290/292.

pMLM290/292 is identical to pST1374 except that it harbors two mutations in the FokI nuclease domain (Q486E, I499L; aka the “-“ mutation see Miller et al., Nat. Biotech 2007, PMID 17603475) which confers heterodimeric behavior on these domains

This zinc finger array was tested for binding activity to the sequence 5'-GAAGAATAG-3' in a bacterial two hybrid assay, and resulted in 3.56 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).

Scientists using this zinc finger array in a publication should notify zebrafishzfs@zincfingers.org and acknowledge NIH grant number R01 GM088040 in the publication.

Other Articles: "Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082)

"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934)

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Rapid "open-source" engineering of customized zinc-finger nucleases for highly efficient gene modification. Maeder et al (Mol Cell. 2008 Jul 25. 31(2):294-301. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35238" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only