zgc:65890_R (OZ600)
(Plasmid #35240)

Loading...
Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    Requires a bacterial strain such as XL1 Blue, that expresses the lacIq allele of lac repressor
  • Copy number
    Low Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    Zinc finger array targeting zgc:65890
  • Alt name
    zgc:65890
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    270
  • Entrez Gene
    zgc:65890 (a.k.a. qkib, qkr, zgc:77340)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer OK.61 GGGTAGTACGATGACGGAACCTGTC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene zgc:65890. Please note that this plasmid does NOT contain the zgc:65890 sequence.

Users must order the complementary plasmid zgc:65890_L (OZ599) [Addgene plasmid 35239] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.

Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290/292 (Addgene plasmids 21872 & 21873), pMLM800/802 (Addgene plasmids 27202 & 27203).

The difference between pMLM800/802 and pMLM290/292 is the length of the “spacer” sequence in the full ZFN target site. If the spacer is 7 bp, scientists should use pMLM800/802. If the spacer is 5 or 6 bps, scientists should use pMLM290/292.

pMLM290/292 is identical to pST1374 except that it harbors two mutations in the FokI nuclease domain (Q486E, I499L; aka the “-“ mutation see Miller et al., Nat. Biotech 2007, PMID 17603475) which confers heterodimeric behavior on these domains

This zinc finger array was tested for binding activity to the sequence 5'-GAGGACGTG-3' in a bacterial two hybrid assay, and resulted in 7.4 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).

Scientists using this zinc finger array in a publication should notify zebrafishzfs@zincfingers.org and acknowledge NIH grant number R01 GM088040 in the publication.

Other Articles: "Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082)

"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934)

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    zgc:65890_R (OZ600) was a gift from Keith Joung (Addgene plasmid # 35240)
  • For your References section:

    Rapid "open-source" engineering of customized zinc-finger nucleases for highly efficient gene modification. Maeder ML, Thibodeau-Beganny S, Osiak A, Wright DA, Anthony RM, Eichtinger M, Jiang T, Foley JE, Winfrey RJ, Townsend JA, Unger-Wallace E, Sander JD, Muller-Lerch F, Fu F, Pearlberg J, Goebel C, Dassie JP, Pruett-Miller SM, Porteus MH, Sgroi DC, Iafrate AJ, Dobbs D, McCray PB, Cathomen T, Voytas DF, Joung JK. Mol Cell. 2008 Jul 25. 31(2):294-301. 10.1016/j.molcel.2008.06.016 PubMed 18657511