Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pcDNA3_NSlmb-vhhGFP4
(Plasmid #35579)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35579 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NSlmb-vhhGFP4
  • Alt name
    slmb
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    951
  • GenBank ID
    AY118898
  • Entrez Gene
    slmb (a.k.a. Dmel_CG3412, BcDNA:GM02031, CG3412, Dmel\CG3412, FBXW1, MENE (3R)-B, MENE(3R)-B, SLIMB, SLMB, Slimb, Slimb/Beta-TRCP1, Slimb/beta-TRCP, Slimb/beta-TrCP, Slimb/betaTrCP, Slmb, beta-TrCP, betaTrCP, crd, ica, l(3)00295, shv, slimb, wel)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer atttaggtgacactatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3_NSlmb-vhhGFP4 was a gift from Markus Affolter (Addgene plasmid # 35579 ; http://n2t.net/addgene:35579 ; RRID:Addgene_35579)
  • For your References section:

    Fluorescent fusion protein knockout mediated by anti-GFP nanobody. Caussinus E, Kanca O, Affolter M. Nat Struct Mol Biol. 2011 Dec 11;19(1):117-21. doi: 10.1038/nsmb.2180. 10.1038/nsmb.2180 PubMed 22157958