Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMKO.1-Zfp423
(Plasmid #35972)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35972 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMKO.1
  • Backbone size w/o insert (bp) 6700
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    zfp423 shRNA
  • gRNA/shRNA sequence
    CCCTGAATGTAACGTGAAGTT
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_033327
  • Entrez Gene
    Zfp423 (a.k.a. Ebfaz, Roaz, Zfp104, Znf423, ataxia1, mKIAA0760, nur12)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pLXSN 5'
  • 3′ sequencing primer pBABE-3
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Forward Oligo 5'
CCGGCCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGGTTTTTG 3'

Reverse Oligo 5'
AATTCAAAAACCCTGAATGTAACGTGAAGTTCTCGAGAACTTCACGTTACATTCAGGG 3'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMKO.1-Zfp423 was a gift from Bruce Spiegelman (Addgene plasmid # 35972 ; http://n2t.net/addgene:35972 ; RRID:Addgene_35972)
  • For your References section:

    Transcriptional control of preadipocyte determination by Zfp423. Gupta RK, Arany Z, Seale P, Mepani RJ, Ye L, Conroe HM, Roby YA, Kulaga H, Reed RR, Spiegelman BM. Nature. 2010 Mar 3. ():. 10.1038/nature08816 PubMed 20200519