pJAM2
(Plasmid #36025)

• Purpose: (Empty Backbone)
• Depositing Labs: Tanya Parish, James Triccas
• Publication: Triccas et al FEMS Microbiol Lett. 1998 Oct 15. 167(2):151-6.

Backbone

• Vector backbone: pJEM12
• Modifications to backbone: The acetamidase promoter region was amplified from plasmid pAMI1, which contains the M. smeg- matis NCTC 9449 inducible acetamidase gene and upstream region, by use of primers HIS5 (CACGGTACCAAGCTTTCTAGCAGA) and HIS7 (GTCAGTGGTGGTGGTGGTGGTGTCTA- GAAGTACTGGATCCGAAAACTACCTCG). The resulting 1.5 kb fragment was cloned into plasmid pJEM12 to give plasmid pJAM2
• Vector type: Bacterial Expression
• Promoter: acetamidase

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Shuttle vector will replicate in E.coli and mycobacteria. Low copy number vector in mycobacteria
• Copy number: Low Copy

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: amidase gene derived from Mahenthiralingam, E., Draper, P., Davis, E.O. and Colston, M.J. (1993) Cloning and sequencing of the gene which en- codes the highly inducible acetamidase of Mycobacterium smegmatis. J. Gen. Microbiol. 139, 575^583.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mycobacterial shuttle expression vector, expression inducible by acetamide.

There are known discrepancies between the Addgene QC sequence and the depositor's full sequence--these are likely due to how the full sequence was assembled and should not affect function.