Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CHOP promoter (-649/+136) pmCherry-1
(Plasmid #36035)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 36035 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmCherry-1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4140
  • Modifications to backbone
    XhoI and BamHI cleaved, removing intervening sequence in the MCS.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CHOP promoter (-647 to +136)
  • Alt name
    CHOP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    787
  • GenBank ID
    NT_029419.12 NM_001195053
  • Entrez Gene
    DDIT3 (a.k.a. AltDDIT3, C/EBPzeta, CEBPZ, CHOP, CHOP-10, CHOP10, GADD153)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer custom: GGCCTTTTGCTCACATGTTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Original human CHOP promoter (-647 to +91) obtained from Pierre Fafournoux. Bruhat, A., Jousse, C., Carraro, V., Reimold, A. M., Ferrara, M., and Fafournoux, P. (2000) Amino acids control mammalian gene transcription. Activating transcription factor 2 is essential for the amino acid responsiveness of the CHOP promoter. Mol. Cell. Biol. 20, 7192–7204
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CHOP promoter (-649/+136) pmCherry-1 was a gift from Quan Lu (Addgene plasmid # 36035 ; http://n2t.net/addgene:36035 ; RRID:Addgene_36035)
  • For your References section:

    Functional RNA Interference (RNAi) Screen Identifies System A Neutral Amino Acid Transporter 2 (SNAT2) as a Mediator of Arsenic-induced Endoplasmic Reticulum Stress. Oh RS, Pan WC, Yalcin A, Zhang H, Guilarte TR, Hotamisligil GS, Christiani DC, Lu Q. J Biol Chem. 2012 Feb 17;287(8):6025-34. Epub 2012 Jan 3. 10.1074/jbc.M111.311217 PubMed 22215663