Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pT7-7 asyn S129A
(Plasmid #36048)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 36048 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pT7-7
  • Backbone size w/o insert (bp) 2438
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    alpha-synuclein S129A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    476
  • Mutation
    S129A
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer AmpStop (TCAGGCAACTATGGATGAAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Lashuel Lab Plasmid #189

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-7 asyn S129A was a gift from Hilal Lashuel (Addgene plasmid # 36048 ; http://n2t.net/addgene:36048 ; RRID:Addgene_36048)
  • For your References section:

    Phosphorylation at Ser-129 but not the phosphomimics S129E/D inhibits the fibrillation of alpha-synuclein. Paleologou KE, Schmid AW, Rospigliosi CC, Kim HY, Lamberto GR, Fredenburg RA, Lansbury PT Jr, Fernandez CO, Eliezer D, Zweckstetter M, Lashuel HA. J Biol Chem. 2008 Jun 13;283(24):16895-905. Epub 2008 Mar 14. 10.1074/jbc.M800747200 PubMed 18343814