Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pZHY013
(Plasmid #36185)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 36185 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR8
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2817
  • Total vector size (bp) 4344
  • Vector type
    Entry vector for expression in plants as a T2A linked polycistronic message

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Heterodimeric FokI nuclease
  • Alt name
    T2A
  • Promoter none

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cagctggtgaagtccgagctgg
  • 3′ sequencing primer gttattaaatttccgtctcacttcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZHY013 was a gift from Daniel Voytas (Addgene plasmid # 36185 ; http://n2t.net/addgene:36185 ; RRID:Addgene_36185)
  • For your References section:

    TALENs enable efficient plant genome engineering. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF. Plant Physiol. 2012 Nov 2. 10.1104/pp.112.205179 PubMed 23124327