1
Plasmid 36232: pCY 3090-07
  • Streptoalloteichus hindustanus bleomycin (Sh ble)

  • 970

  • Streptoalloteichus hindustanus

  • yEpolylinker-mCherry-Zeocin

  • C terminal on backbone

  • pCY 3090-02
    (Search Vector Database)

  • Yeast cassette for PCR and homologous recombination

  • BglII

  • Unknown

  • SacI

  • Unknown

  • CACCATCGTGGAACAGTACG List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • DH5alpha used for DNA recovery of plasmid (i.e. DNA preps).

  • Unknown

  • Zeocin

  • pPICZ (invitrogen); however, the parental vector contains mCherry for which a MTA is needed (R. Tsien lab) -please see http://depts.washington.edu/yeastrc/pages/pBS35.html

  • View sequences (3)
  • Theoretical sequence (application/pdf)

  • Anne Robinson

  • MTA
    Clontech Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Cassette series designed for live-cell imaging of proteins and high-resolution techniques in yeast. Young et al (Yeast. 2012 Mar;29(3-4):119-36. doi: 10.1002/yea.2895. Epub 2012 Apr 4. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 36232" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only