TBRE-TK-Luc-MUT
(Plasmid
#36245)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 36245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTK-luc
- Backbone size w/o insert (bp) 6800
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTwo copies of the Brachyury T-box site
-
MutationMutations in the Brachyury palindromic element:CAC-->GGG and GTG-->CCC
- Promoter TK minimal promoter
-
Tag
/ Fusion Protein
- Luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer n/a
- 3′ sequencing primer Luc_N_Rev (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
Depositor Comments
Mutated Brachyury palindromic element:
AATTTGGGACCTAGGTCCCAAATT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TBRE-TK-Luc-MUT was a gift from Bruce Blumberg (Addgene plasmid # 36245 ; http://n2t.net/addgene:36245 ; RRID:Addgene_36245) -
For your References section:
RIPPLY3 is a retinoic acid-inducible repressor required for setting the borders of the pre-placodal ectoderm. Janesick A, Shiotsugu J, Taketani M, Blumberg B. Development. 2012 Mar;139(6):1213-24. 10.1242/dev.071456 PubMed 22354841