-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJFRC-MUH
- Backbone size w/o insert (bp) 8508
- Total vector size (bp) 8589
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
Insert Size (bp)717
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG
- 3′ sequencing primer p10 R: CGGCCAAATGTTAAACTTGGAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC28-10XUAS-IVS-GFP-p10 was a gift from Gerald Rubin (Addgene plasmid # 36431 ; http://n2t.net/addgene:36431 ; RRID:Addgene_36431) -
For your References section:
Using translational enhancers to increase transgene expression in Drosophila. Pfeiffer BD, Truman JW, Rubin GM. Proc Natl Acad Sci U S A. 2012 Apr 9. 10.1073/pnas.1204520109 PubMed 22493255