This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #36855)


Item Catalog # Description Quantity Price (USD)
Plasmid 36855 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5694
  • Total vector size (bp) 7167
  • Modifications to backbone
    a hygromysin resistance gene was inserted to facilitate selection for stably transfected cells.
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    fluorescent protein voltage sensor
  • Alt name
  • Alt name
  • Alt name
    super ecliptic pHluorin
  • Species
    Ciona intestinalis
  • Insert Size (bp)
  • Mutation
    Ci-VSP contains R217Q mutation; super ecliptic pHluorin contains A227D mutation
  • GenBank ID
    AB183035 AY533296
  • Promoter simian CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GACGTAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TTAAAAAACCTCCCACACCTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.
  • Terms and Licenses
  • Article Citing this Plasmid

Depositor Comments

This construct is composed of the S1-4 domain of the CiVSP voltage sensor. Super ecliptic pHluorin is inserted at position S249 in the CiVSP sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ArcLight-S249 was a gift from Vincent Pieribone (Addgene plasmid # 36855 ; ; RRID:Addgene_36855)
  • For your References section:

    Single action potentials and subthreshold electrical events imaged in neurons with a fluorescent protein voltage probe. Jin L, Han Z, Platisa J, Wooltorton JR, Cohen LB, Pieribone VA. Neuron. 2012 Sep 6;75(5):779-85. 10.1016/j.neuron.2012.06.040 PubMed 22958819