1
Plasmid 37007: pLKO.1-sh-mSox10-2
  • sh-mSox10-2

  • Sox10

  • shRNA against mouse Sox10

  • GGAGGTTGCTGAACGAAAGTG

  • M. musculus (mouse)

  • Sox10 (Dom, Sox21)

  • pLKO.1 puro (Addgene plasmid 8453)
    (Search Vector Database)

  • Weinberg lab

  • Lentiviral, RNAi

  • 7032

  • hU6

  • AgeI

  • Unknown

  • EcoRI

  • Unknown

  • LKO.1 5' List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • Unknown

  • Puromycin

  • View sequences (1)
  • Bob Weinberg

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Slug and Sox9 cooperatively determine the mammary stem cell state. Guo et al (Cell. 2012 Mar 2;148(5):1015-28. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 37007" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only