Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pLKO.1-sh-mSox10-2
(Plasmid #37007)

Loading...
Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pLKO.1 puro (Addgene plasmid 8453)
  • Backbone manufacturer
    Weinberg lab
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    sh-mSox10-2
  • Alt name
    Sox10
  • Alt name
    shRNA against mouse Sox10
  • gRNA/shRNA sequence
    GGAGGTTGCTGAACGAAAGTG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Sox10 (a.k.a. Dom, Sox21)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-sh-mSox10-2 was a gift from Bob Weinberg (Addgene plasmid # 37007)
  • For your References section:

    Slug and Sox9 cooperatively determine the mammary stem cell state. Guo W, Keckesova Z, Donaher JL, Shibue T, Tischler V, Reinhardt F, Itzkovitz S, Noske A, Zurrer-Hardi U, Bell G, Tam WL, Mani SA, van Oudenaarden A, Weinberg RA. Cell. 2012 Mar 2;148(5):1015-28. 10.1016/j.cell.2012.02.008 PubMed 22385965