This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDonor MCS Rosa26
(Plasmid #37200)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37200 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pZDonor AAVS1
  • Backbone manufacturer
    Sigma
  • Total vector size (bp) 4524
  • Modifications to backbone
    mouse Rosa26 targeting arms were PCR amplified and cloned in as described in the manuscript.
  • Vector type
    Genomic targeting - zinc finger

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Rosa26 left targeting arm
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    796

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer M13_pUC-fwd
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    MCS

Gene/Insert 3

  • Gene/Insert name
    Rosa26 right targeting arm
  • Insert Size (bp)
    815

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer NA
  • 3′ sequencing primer M13_pUC-rev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The homology arms in the ROSA26 donor vector were generated by PCR of mouse genomic DNA and insertion of the PCR-amplified right homology arm (left primer: 5-TTATTGCGGCCGCAG ATGGGCGGGAGTCTTCT-3, right primer: 5-AACA CCGCGGCAGTTTATAAATGGAGAAAAAGGAGA -3) between the NotI and SacII sites and the left homology arm (left primer: 5-TCTATGGTACCAGTTAACGGCA GCCGGAGT-3 , right primer: 5 -CGGACGAATTCTCT AGAAAGACTGGAGTTGCAGA-3) between the KpnI and EcoRI sites in the pZDonor AAVS1 vector obtained from Sigma–Aldrich.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDonor MCS Rosa26 was a gift from Charles Gersbach (Addgene plasmid # 37200)
  • For your References section:

    Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases. Perez-Pinera P, Ousterout DG, Brown MT, Gersbach CA. Nucleic Acids Res. 2012 Apr 1;40(8):3741-52. Epub 2011 Dec 14. 10.1093/nar/gkr1214 PubMed 22169954