This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #37259)

Item Catalog # Description Quantity Price (USD)
Plasmid 37259 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

  • Vector backbone
    pBMN iHcRed
  • Backbone manufacturer
    Gary Nolan
  • Backbone size w/o insert (bp) 6940
  • Total vector size (bp) 8462
  • Vector type
  • Selectable markers
    HcRed Fluorescence

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

  • Gene/Insert name
  • Alt name
  • Alt name
    ERS1 ligand binding domain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    6 mutations, T371A, L384M, M421G, G521R, Y537S, N519S
  • GenBank ID
  • Entrez Gene
    ESR1 (a.k.a. ER, ESR, ESRA, ESTRR, Era, NR3A1)
  • Promoter LTR
  • Tag / Fusion Protein
    • YFP-HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ATCGCAGCTTGGATACACGCC
  • 3′ sequencing primer GAGAGGGGCGGAATTTACGTAGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBMN ER50-YFP was a gift from Thomas Wandless (Addgene plasmid # 37259)
  • For your References section:

    Destabilizing domains derived from the human estrogen receptor. Miyazaki Y, Imoto H, Chen LC, Wandless TJ. J Am Chem Soc. 2012 Mar 7;134(9):3942-5. Epub 2012 Feb 22. 10.1021/ja209933r PubMed 22332638