Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #37261)


Item Catalog # Description Quantity Price (USD)
Plasmid 37261 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pBMN iHcRed
  • Backbone manufacturer
    Gary Nolan
  • Backbone size w/o insert (bp) 6940
  • Total vector size (bp) 8453
  • Vector type
  • Selectable markers
    HcRed Fluorescence

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
  • Alt name
    ERS1 ligand binding domain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    6 mutations, T371A, L384M, M421G, G521R, Y537S, N519S
  • GenBank ID
  • Entrez Gene
    ESR1 (a.k.a. ER, ESR, ESRA, ESTRR, Era, NR3A1)
  • Promoter LTR
  • Tag / Fusion Protein
    • HA-YFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer ATCGCAGCTTGGATACACGCC
  • 3′ sequencing primer GAGAGGGGCGGAATTTACGTAGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

There is a G insertion at 1651 compared to the depositor's sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PBMN YFP-ER50 was a gift from Thomas Wandless (Addgene plasmid # 37261)
  • For your References section:

    Destabilizing domains derived from the human estrogen receptor. Miyazaki Y, Imoto H, Chen LC, Wandless TJ. J Am Chem Soc. 2012 Mar 7;134(9):3942-5. Epub 2012 Feb 22. 10.1021/ja209933r PubMed 22332638