pENTR1A-Huwe1 C4341S
(Plasmid #37432)

• Depositing Lab: Jean Cook
• Publication: Huwe1 plasmids (unpublished)

Backbone

• Vector backbone: pENTR1A
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2717
• Total vector size (bp): 16560
• Vector type: Gateway Entry

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Huwe1
• Alt name: Mule
• Alt name: ARF-BP1
• Alt name: Lasu1
• Species: H. sapiens (human)
• Insert Size (bp): 13071
• Mutation: C4341S
• Entrez Gene: HUWE1 (a.k.a. ARF-BP1, HECTH9, HSPC272, Ib772, LASU1, MRXST, MULE, URE-B1, UREB1)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: hHuwe1-R (GCCAAATGTTGTAGCCGAGT)
• 3′ sequencing primer: hHuwe1-F (TATCAGGACTGCCCACCATT)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Full-length cDNA constructed by sequential cloning of PCR products and adding to a partial cDNA.

The ORF sequence provided contains Q2315H and 3016del3031 amino acid mutations compared to closest reference sequence NP_113584.3).