Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pPEP-TEV cNup98 (1-498)
(Plasmid #38037)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 38037 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPEP-TEV
  • Backbone size w/o insert (bp) 2968
  • Total vector size (bp) 4460
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Nucleoporin 98
  • Alt name
    Nup98
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1515
  • Mutation
    amino acids 1-498
  • Entrez Gene
    NUP98 (a.k.a. ADIR2, NUP196, NUP96, Nup98-96)
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag, 3Cysteine (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCGGATCCTGTTGCTGTTTTAACAAATCATTTGGAACA
  • 3′ sequencing primer CCGGAATTCTTAAGAGTCTCCAAAAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pPEP-TEV empty plasmid was obtained from Prof. H. Herrmann and used to derive our plasmid (pPEP-TEV/cNup98)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

see also:
Strelkov, S. V., Kreplak, L., Herrmann, H. & Aebi, U. (2004). Methods Cell Biol.78, 25–43.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPEP-TEV cNup98 (1-498) was a gift from Roderick Lim (Addgene plasmid # 38037 ; http://n2t.net/addgene:38037 ; RRID:Addgene_38037)
  • For your References section:

    Single-molecule transport across an individual biomimetic nuclear pore complex. Kowalczyk SW, Kapinos L, Blosser TR, Magalhaes T, van Nies P, Lim RY, Dekker C. Nat Nanotechnol. 2011 Jun 19;6(7):433-8. doi: 10.1038/nnano.2011.88. 10.1038/nnano.2011.88 PubMed 21685911