pMXs-IP-EGFP-ULK2
(Plasmid
#38201)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXs-IP
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 5847
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUnc-51 like kinase 2
-
Alt nameULK2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3114
-
GenBank IDNM_013881.4
-
Entrez GeneUlk2 (a.k.a. RP23-278F12.5, A830085I22Rik, AU015340, Unc51.2, mKIAA0623)
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CAGCCCTCACTCCTTCTCTAG
- 3′ sequencing primer GAGGAACTGCTTCCTTCACG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-IP-EGFP-ULK2 was a gift from Noboru Mizushima (Addgene plasmid # 38201 ; http://n2t.net/addgene:38201 ; RRID:Addgene_38201) -
For your References section:
FIP200, a ULK-interacting protein, is required for autophagosome formation in mammalian cells. Hara T, Takamura A, Kishi C, Iemura S, Natsume T, Guan JL, Mizushima N. J Cell Biol. 2008 May 5. 181(3):497-510. 10.1083/jcb.200712064 PubMed 18443221