This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #38247)


Item Catalog # Description Quantity Price (USD)
Plasmid 38247 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 2944
  • Total vector size (bp) 2944
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
    A. thaliana (mustard weed)
  • Promoter SV40p
  • Tags / Fusion Proteins
    • VP16 (N terminal on insert)
    • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer GTGAGCGGATAACAATTTCAC
  • 3′ sequencing primer CCC TCA CAT TGC CAA AAG AC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
    A. thaliana (mustard weed)
  • Mutation
  • Promoter SV40 (IRES)
  • Tags / Fusion Proteins
    • Gal4DBD (N terminal on insert)
    • Flag (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer GCACATGCTTTACATGTGTTTAG
  • 3′ sequencing primer gtg agc gga taa caa ttt cac
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that there are minor sequence discrepancies between depositor's reference sequence and Addgene's quality control sequence. These changes are in backbone region only and should not affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SV-ABAactDA was a gift from Jerry Crabtree (Addgene plasmid # 38247)
  • For your References section:

    Engineering the ABA plant stress pathway for regulation of induced proximity. Liang FS, Ho WQ, Crabtree GR. Sci Signal. 2011 Mar 15;4(164):rs2. 10.1126/scisignal.2001449 PubMed 21406691