-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 38268 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXs-puro
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo
- Backbone size w/o insert (bp) 6878
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePhosphatidylinositol 3-kinase catalytic subunit type 3
-
Alt nameVps34
-
Alt namePhosphoinositide-3-kinase class 3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2700
-
GenBank IDBC033004
-
Entrez GenePIK3C3 (a.k.a. VPS34, Vps34, hVps34)
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CAGCCCTCACTCCTTCTCTAG
- 3′ sequencing primer GAAGCACTGCACGCCGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVps34 cDNA was provided by Dr. Tamotsu Yoshimori (Osaka University, Osaka, Japan)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-puro Vps34-GFP was a gift from Noboru Mizushima (Addgene plasmid # 38268 ; http://n2t.net/addgene:38268 ; RRID:Addgene_38268) -
For your References section:
Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Itakura E, Kishi C, Inoue K, Mizushima N. Mol Biol Cell. 2008 Dec . 19(12):5360-72. 10.1091/mbc.e08-01-0080 PubMed 18843052
Map uploaded by the depositor.