TAL2079
(Plasmid
#39449)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 39449 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneJDS71
-
Backbone manufacturerJoung lab (Addgene Plasmid # 32287)
- Backbone size w/o insert (bp) 6447
-
Vector typeMammalian Expression ; T7
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP-TALEN-46-Right
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1844
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3X Flag (N terminal on backbone)
- WT FOKI (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CMV-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Target binding site: TGGCGGATCTTGAAGTTCAC
To reduce the chance of recombination in this plasmid, do not grow in liquid culture for more than 12-14 hours.
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.5kb and 5.8kb
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TAL2079 was a gift from Keith Joung (Addgene plasmid # 39449 ; http://n2t.net/addgene:39449 ; RRID:Addgene_39449) -
For your References section:
FLASH assembly of TALENs for high-throughput genome editing. Reyon D, Tsai SQ, Khayter C, Foden JA, Sander JD, Joung JK. Nat Biotechnol. 2012 Apr 8. doi: 10.1038/nbt.2170. 10.1038/nbt.2170 PubMed 22484455