-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40127 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep15A
- Backbone size w/o insert (bp) 2097
- Total vector size (bp) 2965
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCI inducible sfGFP
-
SpeciesE. Coli
-
GenBank IDJX155239
- Promoter pRM
-
Tag
/ Fusion Protein
- LVA ssrA tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI, BglII (not destroyed)
- 3′ cloning site BamHI, XhoI (not destroyed)
- 5′ sequencing primer GFP-F
- 3′ sequencing primer CCCGAAGGTGAGCCAGTGTGACTCTAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PRM-GFP was a gift from Michel Maharbiz (Addgene plasmid # 40127 ; http://n2t.net/addgene:40127 ; RRID:Addgene_40127) -
For your References section:
A genetic bistable switch utilizing nonlinear protein degradation. Huang DC, Holtz WJ, Maharbiz MM. J Biol Eng. 2012 Jul 9;6(1):9. 10.1186/1754-1611-6-9 PubMed 22776405